Enzymes for cdna synthesis compare and order genomics. Omniscript reverse transcriptase for firststrand cdna synthesis twotube rtpcr pdf 381kb english format file size language download get adobe reader contact qiagen. First strand cdna synthesized with this system can be directly used as a template in pcr or realtime pcr. For your convenience, reagents are available as kits or standalone products, depending on your needs. Analysis of gene expression with microarrays is a major application in functional genomics. Rt reaction is also called first strand cdna synthesis. Kits whose sixdigit lot number begins with a 2 are not. For qrtpcr study i have used maxima 1st strand cdna synthesis kit from fermentas,now the company is part from. Verso cdna kit supplies all the reagents to generate high yields of fulllength cdna. Despite new technologies for sample preparation, array treatment, and data analysis, concerns have been raised regarding the quality of the experimental. Nucleasefree water can be stored at room temperature.
Monsterscript reverse transcriptase is a thermostable reverse transcriptase that completely lacks rnase h activity. The reaction product was purified using the dna extraction kit and then appended with poly a using datp roche applied science and purified again. Thermo scientific revertaid first strand cdna synthesis kit is a complete system for efficient synthesis of first strand cdna from rna templates. The iscript cdna synthesis kit is a sensitive and easytouse firststrand cdna synthesis kit for gene expression analysis using realtime qpcr. In the case of cdna libraries we produce dna copies of the rna sequences usually the mrna of an organism and clone them. First strand cdna synthesis kit 100 x 20 l rxns from thermo fisher scientific. Reverse transcriptase, which has lower rnase h acti first. Selection of the proper cdna synthesis kit is critical for detailed analysis of quantitative gene expression. Thermo scientific first strand cdna synthesis kit is a complete system for efficient synthesis of first strand cdna from mrna or total rna templates. The synthesis reaction can be completed in 1530 minutes. Thermo scientific verso cdna synthesis kit cdna synthesis. First strand cdna synthesis kit direct pcr reagents and kits. Transcriptor first strand cdna synthesis kit roche life science. Reverse transcription rt reaction is a process in which singlestranded rna is reverse transcribed into complementary dna cdna by using total cellular rna or polya rna, a reverse transcriptase enzyme, a primer, dntps and an rnase inhibitor.
Thermo scientific reverse transcription thermo fisher. Monarch nucleic acid purification kits are optimized for maximum performance and minimal environmental impact. This technology is also becoming important in clinical diagnostics, such as the monitoring of gene expression profiles in breast cancer 16. It is important to use highquality rna for your cdna prepar ation. The first and the second strands cdna synthesis was performed with the revertaidtm h minus first strand cdna synthesis kit fermentas, lithuania following the manufacturers instructions. Guaranteed for 12 months at 20c in a constant temperature freezer. Thereafter, mrna expression levels were analyzed by qrtpcr using maxima sybr greenrox qpcr master mix fermentas, hanover, md. Thermo scientific maxima first strand cdna synthesis kit. Sugarcane transcript profiling assessed by cdnaaflp. Using the fermentas first strand cdna synthesis kit quantify we need 0.
Unesco eolss sample chapters genetics and molecular biology reverse transcriptase and cdna synthesis kunitada shimotohno encyclopedia of life support systems eolss 3. Genomic dna was digested with dnase i fermentas, ontario, canada. The tonkbio first chain cdna synthesis kit for rtpcr is optimized to efficiently synthesize first chain cdna from mrna or total rna templates. Betaine reduces pausing and stops by the reverse transcriptase, enabling improved reverse transcription through difficult sequences, such as regions of high gc content. The data were normalized in relation to the internal control. The revertaid first strand cdna synthesis kit is supplied with both oligodt 18 and random hexamer primers. After thawing, mix and briefly centrifuge the components of the kit. The recombinant thermo scientific ribolock rnase inhibitor, supplied with the kit, effectively protects rna from degradation at temperatures up to 55c. The kit is formatted for highyield production of cdna up to 12 kb and each reaction accommodates a.
Choose from a range of reverse transcriptases and rtpcr kits for reverse transcription of fulllength cdna from your experimental sample, including goscript reverse transcriptase, which uses mmlv reverse transcriptase and stateoftheart buffer to drive robust, reliable cdna synthesis of a full range of rare and abundant transcripts. This twotube kit is optimized to yield sensitive, unbiased representation over a broad dynamic range, with minimal setup and reaction time. A cdna library is defined as a collection of cdna fragments, each of which has been cloned into a separate vector molecule. For use in 2step rtpcr applications to create a complete cdna pool prior to pcr. The transcriptor high fidelity cdna synthesis kit is designed to reverse transcribe rna with an. To prepare total rna or mrna, we recommend using roche life science reagents. The result on nanodrop in few of the samples were from 17ngul294ngul, with absorbance of 260280 was ranging in different samples from 1.
The monsterscript 1ststrand cdna synthesis kit has been discontinued. We recommend incubation at 42c for one hour for maximum yield and length. The sensifast cdna synthesis kit displays excellent linearity across a wide range of starting material, revealing the same relative representation in cdna templates, regardless of gene abundance, making it excellent for use in realtime pcr studies. Optimizing a qpcr gene expression quantification assay for s. The verso enzyme cdna synthesis kit is widely used for cdna synthesis, due to its proven ability to produce high yields of fully representative full length cdna from low yields of rna. The first strand cdna synthesis kit is used for the synthesis of the first strand cdna as the starting reaction for rtpcr. Mint2 cdna synthesis kit contains different plugoligo and cds adapters allowing synthesis of cdna with different flanking sequences. Rigi dependent sensing of polydadt via the induction. A complete system for the efficient synthesis of first strand cdna from rna.
The kit uses mmlv reverse transcriptase with lower rnase h activity, which avoids degradation of rna when rnadna hybrid forms in the progress of cdna synthesis. The kit uses mmulv vity compared to amw reverse transcriptase. However, this step can be omitted in some cases unpublished results. Components of the maxi ma first strand cdna sy nthesis kit are premixed to save time and to reduce the possibility of pi. As shown in figure 3, the variation of qpcr volume did not affect the quantification of icaa gene expression p0. Rtpcr reverse transcription pcr reverse transcriptases. This is recommended when the cdna synthesis reaction uses less than 10 ng of rna input. Thermo scientific fermentas first strand cdna synthesis kit is a complete system for the efficient synthesis of first strand cdna from rna templates. Set sample type setting to other sample and the constant to 33. Transcriptor high fidelity cdna synthesis kit sigmaaldrich. First strand cdna synthesis reaction denaturation of rna and primer at 70c for 5 minutes can remove secondary structures that may impede long cdna synthesis. The thermo scientific reverse transcription portfolio offers robust and reliable reverse transcriptases in a variety of optimized formats for efficiency in rtpcr and rtqpcr applications. Tetro cdna synthesis kit contains our highly sensitive mmlv reverse transcriptase, oligo dt 18 and random hexamer primers and all the necessary components to generate high quality cdna from rna templates fig.
Other factors required for reverse transcription metal ions such as magnesium and manganese ions are essential for the reaction, and. For rtpcr of bs3 the cand701fwd atgaatcagaattgctttaattcttgttca and cand. The goscript reverse transcription system is a convenient kit that includes a reverse transcriptase and an optimized set of reagents for efficient synthesis of firststrand cdna optimized in preparation for pcr amplification. Quanta qscript cdna synthesis kit quanta qscript cdna supermix qiagen quantitect reverse transcription kit stratagene affinityscript qpcr cdna synthesis kit. Protocol for cdna synthesis and qrtpcr cdna synthesis. Reverse transcription rt is a widely used application in molecular biology research for rna and expression analysis. Thermo scientific revertaid rt kit is a complete system for efficient synthesis of first strand cdna from mrna or total rna templates. The enzymes lack of rnase h activity contributes to its ability to make longer cdnas and more complete fulllength libraries of firststrand cdna. The oligodt 18 primer anneals selectively to the polya tail of mrna. Affinityscript qpcr cdna synthesis kit provides a streamlined master mix format and fast protocol, with a 15minute cdna synthesis step and an overall protocol time of just 25 minutes. Racepcr was then carried out using the above dacdna as the template and reverse 1 and 2 primers for kiss2 and oligo dt anchor primer in a procedure similar to the 3. Hi, your rna concentration is a bit low but it depends what you are planning to do. The iscript select cdna synthesis kit is a sensitive, flexible, and easytouse kit for the generation of firststrand cdna.
Omniscript reverse transcription handbook en qiagen. Complementary dna cdna is synthesized in a reverse transcription reaction by the enzyme reverse transcriptase from a singlestranded mrna template. The kit uses revertaid reverse transcriptase rt, which has lower rnase h activity compared to amv reverse transcriptase. Order biolines sensifast cdna synthesis kit on zageno. Efficiency kits varied in their ability to efficiently generate cdna from different rna inputs linearity of cdna synthesis kits with bactin 15 20 25 30 35 401. Importance of the efficiency of doublestranded dna. First strand cdna synthesis kit 100 x 20 l rxns k1612 from. The use of random hexamer primers enables priming throughout the length of rna for uniform representation of all rna sequences and allows reverse. The firststrand cdna generated is ideal for pcr fig.
It can be used with either sequencespecific primers, polydt15 primers, or. This robust reverse transcription kit allows a selection of firststrand priming strategies, oligodt primers only, random primers only, or userdesigned genespecific primers. The maxima first strand cdna synthesis kit for rtqpcr is capable of reproducible cdna synthesis from a wide range of total rna amounts 1 pg to 5 g at elevated temperatures 42 to 65c. Some couple cdna synthesis and quantitative realtime pcr in a single reaction. Which cdna synthesis kit should be the best to use for. The synthesis reaction can be completed in 15 to 30 minutes. Rna isolationpurification and firststrand cdna synthesis. Random hexamer primers do not require the presence of the polya tail, therefore, they can be used for transcription of the 5end regions of mrna or cdna. The custom protocol was optimized to maximize reliability of results. The choice of the adapter pair to use for a particular cdna preparation depends on intended application. Please refer to the section below to choose the pair of adapters suitable for your needs. Revertaid first strand cdna synthesis kit thermo fisher scientific.
1 740 1397 674 1473 248 277 615 418 996 1495 169 267 653 1061 1035 177 1204 1152 504 1301 1073 1399 339 520 1092 1014 1324 1250 1362